Cntnap3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cntnap3^em1(IMPC)J
• Name: contactin associated protein-like 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6106859
• Gene: Cntnap3 Location: Chr13:64883996-65051769 bp, - strand Genetic Position: Chr13, 33.46 cM
• Alliance: Cntnap3^em1(IMPC)J page
• IMPC: Cntnap3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGAAGTCTCATAACACT, AAGTAATTTTTAACTGACGC, TCACTCTGCCTATATCCAAA and ATTATCATAGCTTATATCAA, which resulted in a 278 bp deletion beginning at Chromosome 13 negative strand position 64,799,280 bp and ending after 64,799,003 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000321093 (exon 4) and 130 bp of flanking intronic sequence including the splice acceptor and donor. There are 2 additional small deletions, a 5 bp (GGATA) deletion 29 bp before the exon deletion and a 2 bp deletion (GT) 53 bp after he 278 bp deletion, neither of which will alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 133 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cntnap3 Mutation: 57 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)