Serpina3k^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpina3k^em1(IMPC)J
• Name: serine (or cysteine) peptidase inhibitor, clade A, member 3K; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6107619
• Synonyms: KOSA3
• Gene: Serpina3k Location: Chr12:104304745-104311998 bp, + strand Genetic Position: Chr12, 53.99 cM, cytoband F1
• Alliance: Serpina3k^em1(IMPC)J page
• IMPC: Serpina3k gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCCTATCCATGCCTAG, GGTCCCGAGAGTGTTTACAG, GCACCTACAATACACTACAG and GCAACATACAGTACACTGCA, which resulted in a 580 bp deletion beginning at Chromosome 12 positive strand position 104,343,940 bp and ending after 104,344,519 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256671 (exon 4) and 426 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 22 bp deletion 21 bp after the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 304 and early truncation 41 amino acids later. Western blot analysis confirmed the complete absence of protein expression in kidney, heart, liver, lung and brain tissue from homozygous mutant mice. (J:188991, J:345330)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Serpina3k Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)