About   Help   FAQ
Serpina3kem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Serpina3kem1(IMPC)J
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3K; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6107619
Synonyms: KOSA3
Gene: Serpina3k  Location: Chr12:104304745-104311998 bp, + strand  Genetic Position: Chr12, 53.99 cM, cytoband F1
Alliance: Serpina3kem1(IMPC)J page
IMPC: Serpina3k gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCCTATCCATGCCTAG, GGTCCCGAGAGTGTTTACAG, GCACCTACAATACACTACAG and GCAACATACAGTACACTGCA, which resulted in a 580 bp deletion beginning at Chromosome 12 positive strand position 104,343,940 bp and ending after 104,344,519 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256671 (exon 4) and 426 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 22 bp deletion 21 bp after the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 304 and early truncation 41 amino acids later. Western blot analysis confirmed the complete absence of protein expression in kidney, heart, liver, lung and brain tissue from homozygous mutant mice. (J:188991, J:345330)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Serpina3k Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory