Slc2a7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc2a7^em1(IMPC)J
• Name: solute carrier family 2 (facilitated glucose transporter), member 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6107621
• Gene: Slc2a7 Location: Chr4:150233429-150252939 bp, + strand Genetic Position: Chr4, 81.04 cM
• Alliance: Slc2a7^em1(IMPC)J page
• IMPC: Slc2a7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTCACTTCTAGGATTGGGG, GCCTCCACTTCCTCTTTAGG, TAGATGCCCCTAGTCCTTAG and AGCAATGTCATCTTTTCTAG, which resulted in a 324 bp deletion beginning at Chromosome 4 positive strand position 150,149,378 bp and ending after 150,149,701 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463885 (exon 2) and 214 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc2a7 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)