About   Help   FAQ
Slc2a7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc2a7em1(IMPC)J
Name: solute carrier family 2 (facilitated glucose transporter), member 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6107621
Gene: Slc2a7  Location: Chr4:150233429-150252939 bp, + strand  Genetic Position: Chr4, 81.04 cM
Alliance: Slc2a7em1(IMPC)J page
IMPC: Slc2a7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTCACTTCTAGGATTGGGG, GCCTCCACTTCCTCTTTAGG, TAGATGCCCCTAGTCCTTAG and AGCAATGTCATCTTTTCTAG, which resulted in a 324 bp deletion beginning at Chromosome 4 positive strand position 150,149,378 bp and ending after 150,149,701 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463885 (exon 2) and 214 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc2a7 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory