Slc9a5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc9a5^em1(IMPC)J
• Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6107624
• Gene: Slc9a5 Location: Chr8:106075475-106096513 bp, + strand Genetic Position: Chr8, 53.04 cM
• Alliance: Slc9a5^em1(IMPC)J page
• IMPC: Slc9a5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGGAGGGGGCCATACGG, TTCCTCCTAGTCCCCTGGGG, TTGAATGCAGGCCAAGTTGG and GCCTCCTCTGTCCCAAACGC, which resulted in a 205 bp deletion beginning at Chromosome 8 positive strand position 105,355,428 bp and ending after 105,355,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000355153 (exon 4) and 126 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp insertion (AG) at the deletion site that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 221 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc9a5 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)