Sh3rf1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sh3rf1^em1(IMPC)J
• Name: SH3 domain containing ring finger 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6108885
• Gene: Sh3rf1 Location: Chr8:61676906-61849105 bp, + strand Genetic Position: Chr8, 30.94 cM
• Alliance: Sh3rf1^em1(IMPC)J page
• IMPC: Sh3rf1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCATGCACAACAGAACCAGC, TTTCATGTGAAGTAACCTGC, GTATTCTGAAAACTTCTACC and GTTTGAGATGAGTGTTTACG, which resulted in a 436 bp deletion beginning at Chromosome 8 negative strand position 61,361,896 bp and ending after 61,361,461 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000211426 (exon 7) and 251 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 393 and early truncation 26 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sh3rf1 Mutation: 54 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)