Mettl6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mettl6^em1(IMPC)J
• Name: methyltransferase 6, methylcytidine; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6108888
• Gene: Mettl6 Location: Chr14:31195535-31216997 bp, - strand Genetic Position: Chr14, 19.12 cM
• Alliance: Mettl6^em1(IMPC)J page
• IMPC: Mettl6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGGAGTGCTGCCTGGGCA, CTCACTAGTCATGTCCCCAC, AGAGCAACCATTCATAGTAA and GAATTAAAACACAGACCAGT, which resulted in a 390 bp deletion beginning at Chromosome 14 negative strand position 31,483,013 bp and ending after 31,482,624 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000121655 (exon 5) and 248 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 9 bp insertion at the 390 bp deletion site (AGTGAGTGA) and 4 bp deletion (TAGT) 37 bp before the 390 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 177 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mettl6 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)