Wdr41^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr41^em1(IMPC)J
• Name: WD repeat domain 41; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6109968
• Gene: Wdr41 Location: Chr13:95112852-95159821 bp, + strand Genetic Position: Chr13, 49.22 cM
• Alliance: Wdr41^em1(IMPC)J page
• IMPC: Wdr41 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAATACATACCAGTTCTACA, GGCCCAGTAGTTTTAAAGTC, TAAATGCTACAATTTTCAGT and TCTTTGTCAGCATTGACCAC, which resulted in a 391 bp deletion beginning at Chromosome 13 positive strand position 94,978,329 bp and ending after 94,978,719 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262273 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 96 bp before the 391 bp deletion there are 2 small intronic indels, a 5 bp (GTTGA) insertion followed 8 bp after that insertion by an 11 bp deletion (GTAGTTTTAAA) that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 17 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wdr41 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)