About   Help   FAQ
Ppfia3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ppfia3em1(IMPC)J
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6109981
Gene: Ppfia3  Location: Chr7:44988550-45016443 bp, - strand  Genetic Position: Chr7, 29.26 cM
Alliance: Ppfia3em1(IMPC)J page
IMPC: Ppfia3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGCCACAGACAGAAAGGGC, GGAGCTTGCCACAGACAGAA, GATGAGGGATGGGTTAAGGA and GTTGAGTGAGACATGAAGGG, which resulted in a 824 bp deletion beginning at Chromosome 7 negative strand position 45,355,486 bp and ending after 45,354,663 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273174, ENSMUSE1236795, ENSMUSE00001284496 (exons 11-13) and 549 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 415 and early truncation 44 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ppfia3 Mutation:  47 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory