About   Help   FAQ
Il2raem1Mson
Endonuclease-mediated Allele Detail
Summary
Symbol: Il2raem1Mson
Name: interleukin 2 receptor, alpha chain; endonuclease-mediated mutation 1, Alexander Marson
MGI ID: MGI:6110563
Synonyms: SNP
Gene: Il2ra  Location: Chr2:11647618-11698004 bp, + strand  Genetic Position: Chr2, 8.91 cM, cytoband A2-A3
Alliance: Il2raem1Mson page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutations:    Insertion, Single point mutation
 
Mutation detailsCRISPR/Cas9 technology inserted an Il2ra intron 1 enhancer region guide RNA and Cas9 mRNA. The gRNA carries a C to T mutation associated with human inflammatory bowel disease (GAAGGAGGTATCTATTTTGGTCCC to GAAGGAGGTATTTATTTTGGTCCC) and Type 1 Diabetes (T1D). Expression of the Il2ra gene is not blocked, but in vitro gene activation in response to cell stimulation with anti-CD3/CD28 antibodies is delayed. (J:253576)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Il2ra Mutation:  51 strains or lines available
References
Original:  J:253576 Simeonov DR, et al., Discovery of stimulation-responsive immune enhancers with CRISPR activation. Nature. 2017 Sep 7;549(7670):111-115
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory