Uck2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Uck2^em1(IMPC)J
• Name: uridine-cytidine kinase 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6111455
• Gene: Uck2 Location: Chr1:167050464-167112657 bp, - strand Genetic Position: Chr1, 74.61 cM
• Alliance: Uck2^em1(IMPC)J page
• IMPC: Uck2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATCAATCAGAAAGGCCAG, TCCTGTCCACACATACCATA, AAAACGGTAAGACAGTGCCG and TATATTACTAGAGCTCAGGG, which resulted in a 709 bp deletion beginning at Chromosome 1 negative strand position 167,237,777 bp and ending after 167,237,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000160510 (exon 2) and 549 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 51 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Uck2 Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)