Srsf6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Srsf6^em1(IMPC)J
• Name: serine and arginine-rich splicing factor 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6111460
• Gene: Srsf6 Location: Chr2:162773448-162779041 bp, + strand Genetic Position: Chr2, 83.87 cM
• Alliance: Srsf6^em1(IMPC)J page
• IMPC: Srsf6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTCACTCTCTAACAGATTGT, CTGTAAAATAAAACTTAGCG, CAGATATTCTAGCCACAGAT and GTTGTATTTACGGTGTTTCT, which resulted in a 736 bp deletion beginning at Chromosome 2 positive strand position 162,933,223 bp and ending after 162,933,958 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226087 and ENSMUSE00001223759 (exons 3 and 4) and 402 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 92 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Srsf6 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)