About   Help   FAQ
Srsf6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Srsf6em1(IMPC)J
Name: serine and arginine-rich splicing factor 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6111460
Gene: Srsf6  Location: Chr2:162773448-162779041 bp, + strand  Genetic Position: Chr2, 83.87 cM
Alliance: Srsf6em1(IMPC)J page
IMPC: Srsf6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTCACTCTCTAACAGATTGT, CTGTAAAATAAAACTTAGCG, CAGATATTCTAGCCACAGAT and GTTGTATTTACGGTGTTTCT, which resulted in a 736 bp deletion beginning at Chromosome 2 positive strand position 162,933,223 bp and ending after 162,933,958 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226087 and ENSMUSE00001223759 (exons 3 and 4) and 402 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 92 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Srsf6 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory