Stard9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stard9^em1(IMPC)J
• Name: StAR related lipid transfer domain containing 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6111462
• Gene: Stard9 Location: Chr2:120459602-120562376 bp, + strand Genetic Position: Chr2, 60.37 cM, cytoband F1
• Alliance: Stard9^em1(IMPC)J page
• IMPC: Stard9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCAGGAGAGACTAACAAAA, GGTGCTTTGTGGTAAGATGA, GCTAGTCCGGGGCAACCCAA and TTTCACGTCAGGGTCAGCAG, which resulted in a 453 bp deletion beginning at Chromosome 2 positive strand position 120,666,304 bp and ending after 120,666,756 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000167832 and ENSMUSE00000167830 (exons 5 and 6) and 358 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp deletion (GTCCGTCCCTTTTGTTA) 96 bp before the 453 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 117 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Stard9 Mutation: 189 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)