Itfg2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Itfg2^em1(IMPC)J
• Name: integrin alpha FG-GAP repeat containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6111974
• Gene: Itfg2 Location: Chr6:128386407-128401873 bp, - strand Genetic Position: Chr6, 62.99 cM
• Alliance: Itfg2^em1(IMPC)J page
• IMPC: Itfg2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTTCCTGGGCAGACCCCA, AACACTGCACATGTGCACCA, GGTTTGTCCATATAGCAAAG and TCGAGATGAATGTTCTCTCT, which resulted in a 507 bp deletion beginning at Chromosome 6 negative strand position 128,416,346 bp and ending after 128,415,840 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001296813 and ENSMUSE00001250898 (exons 3 and 4) and 296 bp of flanking intronic sequence including the splice acceptors and donors. In addition, there are 2 small intronic indels, a 1 bp (G) deletion 108 bp before the exon deletion and a 2 bp deletion (GT) 62 bp after the deletion that will not alter the results of the exons being deleted. This mutation is predicted to cause a change of amino acid sequence after residue 64 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Itfg2 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)