About   Help   FAQ
Itfg2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Itfg2em1(IMPC)J
Name: integrin alpha FG-GAP repeat containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6111974
Gene: Itfg2  Location: Chr6:128386407-128401873 bp, - strand  Genetic Position: Chr6, 62.99 cM
Alliance: Itfg2em1(IMPC)J page
IMPC: Itfg2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTTCCTGGGCAGACCCCA, AACACTGCACATGTGCACCA, GGTTTGTCCATATAGCAAAG and TCGAGATGAATGTTCTCTCT, which resulted in a 507 bp deletion beginning at Chromosome 6 negative strand position 128,416,346 bp and ending after 128,415,840 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001296813 and ENSMUSE00001250898 (exons 3 and 4) and 296 bp of flanking intronic sequence including the splice acceptors and donors. In addition, there are 2 small intronic indels, a 1 bp (G) deletion 108 bp before the exon deletion and a 2 bp deletion (GT) 62 bp after the deletion that will not alter the results of the exons being deleted. This mutation is predicted to cause a change of amino acid sequence after residue 64 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Itfg2 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory