Srek1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Srek1^em1(IMPC)J
• Name: splicing regulatory glutamine/lysine-rich protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6112028
• Gene: Srek1 Location: Chr13:103875856-103911116 bp, - strand Genetic Position: Chr13, 56.16 cM
• Alliance: Srek1^em1(IMPC)J page
• IMPC: Srek1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCCTGTACAACAACACTG, GTGTTTCTGCGAGGCTAGAA, AGTAGTGCTCTATTTAGTTG and AGATCAGTCATCACTTTCTA, which resulted in a 384 bp deletion beginning at Chromosome 13 negative strand position 103,759,538 bp and ending after 103,759,155 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314888 (exon 4) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 139 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Srek1 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)