Slc36a2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc36a2^em1(IMPC)J
• Name: solute carrier family 36 (proton/amino acid symporter), member 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6114754
• Gene: Slc36a2 Location: Chr11:55049296-55075903 bp, - strand Genetic Position: Chr11, 32.16 cM
• Alliance: Slc36a2^em1(IMPC)J page
• IMPC: Slc36a2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTAGCAGTCAGTGCTTGG, GTAAAGGTAGACTGGGTAAC, CAGCACTTCAATTACCTGCG and AGGATACAGGAAAATCGAGA, which resulted in a 479 bp deletion beginning at Chromosome 11 negative strand position 55,181,761 bp and ending after 55,181,283 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295210 (exon 2) and 388 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc36a2 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)