About   Help   FAQ
Myom2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Myom2em1(IMPC)J
Name: myomesin 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6114782
Gene: Myom2  Location: Chr8:15107653-15183410 bp, + strand  Genetic Position: Chr8, 7.63 cM
Alliance: Myom2em1(IMPC)J page
IMPC: Myom2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAGTTGTCCTATGACCAA, CATGAGAGACTGAAATACTT, TCTAATGCTTCACTAACCGT and CCTTTTCTACACCCCGAGGG, which resulted in a 508 bp deletion beginning at Chromosome 8 negative strand position 15,069,595 bp and ending after 15,069,088 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001260151 (exon 4) and 369 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Myom2 Mutation:  98 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/22/2024
MGI 6.24
The Jackson Laboratory