Asb17^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Asb17^em1(IMPC)J
• Name: ankyrin repeat and SOCS box-containing 17; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6114790
• Gene: Asb17 Location: Chr3:153549884-153559252 bp, + strand Genetic Position: Chr3, 78.68 cM
• Alliance: Asb17^em1(IMPC)J page
• IMPC: Asb17 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGTGGTGTGATGTGAAAGG, GGTGAACGTTAGTTACATGG, GTGTTAGGACATAATTGCAA and TCCCCACGCCCTGAGAAGGG, which resulted in a 578 bp deletion beginning at Chromosome 3 positive strand position 153,850,524 bp and ending after 153,851,101 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000257803 (exon 2) and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Asb17 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)