Cspp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cspp1^em1(IMPC)J
• Name: centrosome and spindle pole associated protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6117093
• Gene: Cspp1 Location: Chr1:10108212-10206993 bp, + strand Genetic Position: Chr1, 2.3 cM, cytoband A2
• Alliance: Cspp1^em1(IMPC)J page
• IMPC: Cspp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTATTGGGCCAGGAGGCTAG, GAGTTACTATTAAGTACACT, TGTTGCCTAATTGTGATTGG and TGAGTCTTACATATGGCAAT, which resulted in a 592 bp deletion beginning at Chromosome 1 positive strand position 10,047,149 bp and ending after 10,047,740 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001255443 (exon 3) and 489 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cspp1 Mutation: 82 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)