H2-K1^d-em1Dvs
Endonuclease-mediated Allele Detail

Summary

• Symbol: H2-K1^d-em1Dvs
• Name: histocompatibility 2, K1, K region; endonuclease-mediated mutation 1, David V Serreze
• MGI ID: MGI:6119459
• Synonyms: H2-K1^em1Dvs
• Gene: H2-K1 Location: Chr17:34214986-34219316 bp, - strand Genetic Position: Chr17, 17.98 cM
• Alliance: H2-K1^d-em1Dvs page

Mutation origin

• Strain of Origin: NOD/ShiLtDvs

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1^em5Dvs. (J:257229)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 4 strains available Cell Lines: 0 lines available
• Carrying any H2-K1 Mutation: 60 strains or lines available

References

• Original: J:257229 Racine JJ, et al., Improved Murine MHC-Deficient HLA Transgenic NOD Mouse Models for Type 1 Diabetes Therapy Development. Diabetes. 2018 May;67(5):923-935
• All: 4 reference(s)