H2-D1^b-em5Dvs
Endonuclease-mediated Allele Detail

Summary

• Symbol: H2-D1^b-em5Dvs
• Name: histocompatibility 2, D region locus 1; endonuclease-mediated mutation 5, David V Serreze
• MGI ID: MGI:6119467
• Gene: H2-D1 Location: Chr17:35482070-35486473 bp, + strand Genetic Position: Chr17, 18.61 cM
• Alliance: H2-D1^b-em5Dvs page

Mutation origin

• Strain of Origin: NOD/ShiLtDvs

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1^em1Dvs. (J:257229)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 4 strains available Cell Lines: 0 lines available
• Carrying any H2-D1 Mutation: 47 strains or lines available

References

• Original: J:257229 Racine JJ, et al., Improved Murine MHC-Deficient HLA Transgenic NOD Mouse Models for Type 1 Diabetes Therapy Development. Diabetes. 2018 May;67(5):923-935
• All: 4 reference(s)