Tomm20^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tomm20^em1(IMPC)J
• Name: translocase of outer mitochondrial membrane 20; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6120515
• Synonyms: Tomm20^-
• Gene: Tomm20 Location: Chr8:127657417-127672594 bp, - strand Genetic Position: Chr8, 74.64 cM, cytoband E2
• Alliance: Tomm20^em1(IMPC)J page
• IMPC: Tomm20 gene page

Tomm20^em1(IMPC)J/Tomm20^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts do not hatch from the zona pollucida or form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences CTAACAGAGCTTCTCAAACT, TTTGCTCTTACCACCACCAA, GTTCACTCGCCAGGGAGGCA and ACGTTTTGTAGAATTAATGA, which resulted in a 396 bp deletion beginning at Chromosome 8 position 126,940,940 bp and ending after 126,941,335 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000480474 (exon 2) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tomm20 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)