Tubb4b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tubb4b^em1(IMPC)J
• Name: tubulin, beta 4B class IVB; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6120520
• Gene: Tubb4b Location: Chr2:25112172-25114714 bp, - strand Genetic Position: Chr2, 17.08 cM, cytoband A3
• Alliance: Tubb4b^em1(IMPC)J page
• IMPC: Tubb4b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCTTCCTTAATAGCCACC, AGGAAGGTCCAACTGACTGC, CCAGGGCGACGAATCCCTAA and GGTATCCAGGACGCAATGAA, which resulted in a 742 bp deletion beginning at Chromosome 2 position 25,223,727 bp and ending after 25,224,468 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000569385, ENSMUSE00000569384 (exons 3 and 4) and 522 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp insertion, GC, at the site of the deletion which will not alter the results of the 742 bp deletion. This deletion is predicted to cause a change of amino acid sequence after residue 19 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tubb4b Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)