Prrc2c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prrc2c^em1(IMPC)J
• Name: proline-rich coiled-coil 2C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6143826
• Gene: Prrc2c Location: Chr1:162499354-162568125 bp, - strand Genetic Position: Chr1, 70.3 cM, cytoband H1
• Alliance: Prrc2c^em1(IMPC)J page
• IMPC: Prrc2c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCTGAACAGTGCACAGCGG, ACTCTATTCTTGGAGTTAGT, ATAGAGCTCTACTTTAACAT and AGATGGCTTAATATTTTGAG, which resulted in a 757 bp deletion beginning at Chromosome 1 position 162,722,830 bp and ending after 162,723,586 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264518 (exon 3) and 579 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prrc2c Mutation: 120 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)