Relch^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Relch^em1(IMPC)J
• Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6143833
• Gene: Relch Location: Chr1:105591570-105682856 bp, + strand Genetic Position: Chr1, 49.64 cM, cytoband D
• Alliance: Relch^em1(IMPC)J page
• IMPC: Relch gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGCATCCAACCAAGAAAA, TGCGTTCACAAGTTTCATAA, GTAGTTTCTAAAATCAAAGC and TCAGGCTATAAAAAGTTACC, which resulted in a 696 bp deletion beginning at Chromosome 1 position 105,686,903 bp and ending after 105,687,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370997, ENSMUSE00000385562, ENSMUSE00000348886 (exons 3,4,5) and 454 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (T) insertion and 7 bp deletion (ATAAAGG) 83 bp before the 696 bp deletion that will not affect the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 205 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Relch Mutation: 83 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)