Vgf^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vgf^em1(IMPC)H
• Name: VGF nerve growth factor inducible; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6144255
• Gene: Vgf Location: Chr5:137055246-137062205 bp, + strand Genetic Position: Chr5, 76.13 cM
• Alliance: Vgf^em1(IMPC)H page
• IMPC: Vgf gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and the guide sequence CCCCCCGGGCGCCCCGATGTTTT, which resulted in a Indel. (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Vgf Mutation: 26 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)