Ecpas^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ecpas^em1(IMPC)J
• Name: Ecm29 proteasome adaptor and scaffold; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6147390
• Gene: Ecpas Location: Chr4:58798911-58912749 bp, - strand Genetic Position: Chr4, 32.35 cM
• Alliance: Ecpas^em1(IMPC)J page
• IMPC: Ecpas gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGATGGGAACAGGTAAGCG, GCTTGGGCTTGTTTACCTGA, TTGGAAGCTGTAATAAACAG and ACATGTCAATTACTACTGCT, which resulted in a 289 bp deletion beginning at Chromosome 4 position 58,876,921 bp and ending after 58,877,209 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527161 (exon 4) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp insertion (GAAT) and a 6 bp deletion (TAAACA)47 bp before the 289 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 90 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ecpas Mutation: 93 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)