Rhobtb1^{em2(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rhobtb1^{em2(IMPC)Ccpcz}
• Name: Rho-related BTB domain containing 1; endonuclease-mediated mutation 2, Institute of Molecular Genetics
• MGI ID: MGI:6147537
• Synonyms: Rhobtb1^em2(IMPC)Ph
• Gene: Rhobtb1 Location: Chr10:68987264-69127621 bp, + strand Genetic Position: Chr10, 36.04 cM, cytoband B5.1
• Alliance: Rhobtb1^{em2(IMPC)Ccpcz} page
• IMPC: Rhobtb1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 RNA and the guide sequence TCGTGGGCGACAACGCCGTAGGG, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rhobtb1 Mutation: 36 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)