Ralgapa1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ralgapa1^em1(IMPC)J
• Name: Ral GTPase activating protein, alpha subunit 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6147545
• Gene: Ralgapa1 Location: Chr12:55649681-55867952 bp, - strand Genetic Position: Chr12, 24.06 cM
• Alliance: Ralgapa1^em1(IMPC)J page
• IMPC: Ralgapa1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATTAAGTTCTTCAAAAGGC, TATGCTAAGGAGTAGTGAGA and TTTAGACAAATGCTAAATCA, which resulted in a 313 bp deletion beginning at Chromosome 12 position 55,794,879 bp and ending after 55,795,191 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370584(exon 3) and 263 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (TGAG) 15 bp before the 313 bp deletion that will not alter the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ralgapa1 Mutation: 143 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)