Tspan9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tspan9^em1(IMPC)J
• Name: tetraspanin 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6147563
• Gene: Tspan9 Location: Chr6:127938359-128120541 bp, - strand Genetic Position: Chr6, 62.73 cM
• Alliance: Tspan9^em1(IMPC)J page
• IMPC: Tspan9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTAAAACCCTGAAAGCAGG, CCTGTAAAGCTGGTGACCCG, TCAGTGTTCAGTGAGACGAA and GCCTCGTCCCATTTACTGTA, which resulted in a 2472 bp deletion beginning at Chromosome 6 position 127,965,063 bp and ending after 127,967,534 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254362, ENSMUSE00000197715, ENSMUSE00000197720, ENSMUSE00000197719, ENSMUSE00000239192 (exons 4, 5, 6, 7, and 8) and 1887 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is an 8 bp deletion (CTGCTTTC) 70 bp after the 2472 bp deletion that will not affect the results of the deletion. This mutation is predicted to cause an in-frame deletion of 195 amino acids after amino acid residue 21 and retain the last 23 amino acids in-frame. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tspan9 Mutation: 147 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)