Htr3a^em1.1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Htr3a^em1.1(IMPC)J
• Name: 5-hydroxytryptamine (serotonin) receptor 3A; endonuclease-mediated mutation 1.1, Jackson
• MGI ID: MGI:6147798
• Gene: Htr3a Location: Chr9:48810513-48822399 bp, - strand Genetic Position: Chr9, 26.53 cM
• Alliance: Htr3a^em1.1(IMPC)J page
• IMPC: Htr3a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The conditional-ready parent allele was generated at The Jackson Laboratory by pronuclear injection of Cas9 RNA and 2 guide sequences TTTCTGACCCACTGTTATCG and GATGAAGAGAGGATACATCC, with plasmid donor Htr3a_Floxed exon 5, which contains exon 5 flanked by loxP and HindIII sites and 1kb homology arms. This produced a 2,513 bp knock-in beginning at Chromosome 9 negative strand position 48,905,948 bp GCTTCTGGTCACAGATGAG, and ending after AGTGGAGGGCTAGGAAAGGC at 48,903,515 bp (GRCm38/mm10). This knock-in added a single bp change C to G 5 bp before the addition of a 34 bp loxP site followed by a 6 bp HindIII restriction site (AAGCTT) to the 5-prime side of exon 5, 195 bp upstream (5-prime) of the exon, and a second single base pair C to G change 55 bp downstream (3-prime) of the exon, followed 5 bp later by another HindIII restriction site (AAGCTT) and a 34 bp loxP site. Subsequent Cre excision deleted all 170 bp of exon 5 as well as 240 bp of flanking intronic sequence for a total deletion of 410 bp. This deletion is predicted to cause a change of amino acid sequence after residue 130 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Htr3a Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)