Hnrnph2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hnrnph2^em1(IMPC)J
• Name: heterogeneous nuclear ribonucleoprotein H2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6147827
• Gene: Hnrnph2 Location: ChrX:133501928-133507809 bp, + strand Genetic Position: ChrX, 56.2 cM
• Alliance: Hnrnph2^em1(IMPC)J page
• IMPC: Hnrnph2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CACCATGATGCTGAGCACAG and TTGAGTTTTCCTGAAGAACT which resulted in a 1451 bp deletion beginning at Chromosome X position 134,604,908 bp and ending after 134,606,358 bp (GRCm38/mm10). This mutation deletes most of the coding sequence of ENSMUSE00000653740 (exon 4) leaving 53 bp of 5' UTR with the deletion beginning just before the ATG and ending in the 3' UTR 100 bp after the TAA stop. This is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hnrnph2 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)