About   Help   FAQ
Hnrnph2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hnrnph2em1(IMPC)J
Name: heterogeneous nuclear ribonucleoprotein H2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6147827
Gene: Hnrnph2  Location: ChrX:133501928-133507809 bp, + strand  Genetic Position: ChrX, 56.2 cM
Alliance: Hnrnph2em1(IMPC)J page
IMPC: Hnrnph2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CACCATGATGCTGAGCACAG and TTGAGTTTTCCTGAAGAACT which resulted in a 1451 bp deletion beginning at Chromosome X position 134,604,908 bp and ending after 134,606,358 bp (GRCm38/mm10). This mutation deletes most of the coding sequence of ENSMUSE00000653740 (exon 4) leaving 53 bp of 5' UTR with the deletion beginning just before the ATG and ending in the 3' UTR 100 bp after the TAA stop. This is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hnrnph2 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory