Atp6v1g2^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp6v1g2^{em1(IMPC)Rbrc}
• Name: ATPase, H+ transporting, lysosomal V1 subunit G2; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6148314
• Synonyms: Atp6v1g2^em1Rbrc
• Gene: Atp6v1g2 Location: Chr17:35453910-35457743 bp, + strand Genetic Position: Chr17, 18.6 cM, cytoband B2
• Alliance: Atp6v1g2^{em1(IMPC)Rbrc} page
• IMPC: Atp6v1g2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 RNA and 2 guide sequences CGGAGAAGGTGGCCGATGCCAGG, GAGGAATCGGGAGCGCGTCCTGG, which resulted in a Inter-exdel deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Atp6v1g2 Mutation: 17 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)