Fam135b^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam135b^{em1(IMPC)Rbrc}
• Name: family with sequence similarity 135, member B; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6148317
• Synonyms: Fam135b^em1Rbrc
• Gene: Fam135b Location: Chr15:71310800-71600282 bp, - strand Genetic Position: Chr15, 32.19 cM, cytoband D3
• Alliance: Fam135b^{em1(IMPC)Rbrc} page
• IMPC: Fam135b gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences CCGGAAAAGCATGGCGTCATTTA, CTTCGTTTCTGTATAAGATCTGG, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fam135b Mutation: 71 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)