About   Help   FAQ
Ikzf4em1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
Summary
Symbol: Ikzf4em1(IMPC)Rbrc
Name: IKAROS family zinc finger 4; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID: MGI:6148319
Synonyms: Ikzf4em1Rbrc
Gene: Ikzf4  Location: Chr10:128466712-128505227 bp, - strand  Genetic Position: Chr10, 77.11 cM, cytoband D3
Alliance: Ikzf4em1(IMPC)Rbrc page
IMPC: Ikzf4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences CCGGATGCCGCCAGGGGAGTGAG, CTTCCATCGCAGTAGCCTAAGGG, which resulted in a Indel. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ikzf4 Mutation:  33 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory