Wwp1^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wwp1^em1(IMPC)H
• Name: WW domain containing E3 ubiquitin protein ligase 1; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6149154
• Gene: Wwp1 Location: Chr4:19608303-19708993 bp, - strand Genetic Position: Chr4, 7.56 cM
• Alliance: Wwp1^em1(IMPC)H page
• IMPC: Wwp1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, 4 guide sequences CCTGGGGCAAGATGCATGACAAT, GTAAGGTGCCTGACAAGAGATGG, AAGTCTTGATCTTTTGAGACAGG, CCATTGAGCTGCTTAAGCAAGTT, and a donor oligo, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Wwp1 Mutation: 64 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)