Gckr^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gckr^em1(IMPC)H
• Name: glucokinase regulatory protein; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6149158
• Gene: Gckr Location: Chr5:31454787-31484658 bp, + strand Genetic Position: Chr5, 17.27 cM
• Alliance: Gckr^em1(IMPC)H page
• IMPC: Gckr gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCAGTGTGTTCATGGCGGAGCCA, TCCACAAAACCCAGTAAAGTTGG, CCAGCCCCCAAATGTCTTTTTAG, TTAGTCTCCAACATCCCTTGTGG, which resulted in a 1262 nt deletion in exons ENSMUSE00000487442 and ENSMUSE00000486780. (J:237616, J:337481)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Gckr Mutation: 42 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 5 reference(s)