Plaur^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plaur^em1(IMPC)H
• Name: plasminogen activator, urokinase receptor; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6149208
• Gene: Plaur Location: Chr7:24161909-24175393 bp, + strand Genetic Position: Chr7, 10.92 cM, cytoband A3
• Alliance: Plaur^em1(IMPC)H page
• IMPC: Plaur gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 2 guide sequences GGACTACCGTGCTTCGGGAATGG, TCTGCAGGACTACCGTGCTTCGG, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Plaur Mutation: 18 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)