Ap3m2^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ap3m2^em2(IMPC)H
• Name: adaptor-related protein complex 3, mu 2 subunit; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6149217
• Gene: Ap3m2 Location: Chr8:23277370-23295638 bp, - strand Genetic Position: Chr8, 11.42 cM
• Alliance: Ap3m2^em2(IMPC)H page
• IMPC: Ap3m2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence TGGAAGCTGGTCCCCCACATTGG, and a donor oligo, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Ap3m2 Mutation: 24 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)