Cep350^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep350^em1(IMPC)J
• Name: centrosomal protein 350; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6149747
• Gene: Cep350 Location: Chr1:155720710-155848976 bp, - strand Genetic Position: Chr1, 67.64 cM
• Alliance: Cep350^em1(IMPC)J page
• IMPC: Cep350 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGAGTTGATAGGTAGGG, AGACACTGCAGTAGGGTCTC, GGATACTCAGTTCACACCGA and GCATTGGATAAGGGCTGAAG, which resulted in a 392 bp deletion beginning at Chromosome 1 position 155,960,980 bp and ending after 155,961,371 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000537328 (exon 3) and 348 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small indel, a 1 bp (T) insertion and 4 bp (GGTA) deletion, 88 bp after the 392 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cep350 Mutation: 112 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)