About   Help   FAQ
Tgem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tgem1(IMPC)J
Name: thyroglobulin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6149762
Gene: Tg  Location: Chr15:66542606-66722570 bp, + strand  Genetic Position: Chr15, 29.3 cM, cytoband D3-E
Alliance: Tgem1(IMPC)J page
IMPC: Tg gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCAATGCGAGTTGCAGGG, ACAACGCTGGCAAAAAAGGG, TATGACCTGTAGTTGTTGAA and ATAATGAGCCCTTTTCCATT, which resulted in a 372 bp deletion beginning at Chromosome 15 position 66,672,114 bp and ending after 66,672,485 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000439658 (exon 3) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tg Mutation:  147 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory