About   Help   FAQ
Mypnem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mypnem1(IMPC)J
Name: myopalladin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6149973
Gene: Mypn  Location: Chr10:62951574-63039731 bp, - strand  Genetic Position: Chr10, 32.54 cM
Alliance: Mypnem1(IMPC)J page
IMPC: Mypn gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCATTATAACGGGAATTCAT, AGTTACGTAAACATTTGTAG, CAGAATGCGAAGTAAACCTT and GCTTGTATGTAGGTCTCCTC, which resulted in a 579 bp deletion beginning at Chromosome 10 position 63,169,099 bp and ending after 63,169,677 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000420052 (exon 3) and 403 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 9 bp insertion (TGCCTTGGT) at the deletion site and a single bp insertion (A) 38 bp after the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 299 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mypn Mutation:  77 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory