Mypn^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mypn^em1(IMPC)J
• Name: myopalladin; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6149973
• Gene: Mypn Location: Chr10:62951574-63039731 bp, - strand Genetic Position: Chr10, 32.54 cM
• Alliance: Mypn^em1(IMPC)J page
• IMPC: Mypn gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCATTATAACGGGAATTCAT, AGTTACGTAAACATTTGTAG, CAGAATGCGAAGTAAACCTT and GCTTGTATGTAGGTCTCCTC, which resulted in a 579 bp deletion beginning at Chromosome 10 position 63,169,099 bp and ending after 63,169,677 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000420052 (exon 3) and 403 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 9 bp insertion (TGCCTTGGT) at the deletion site and a single bp insertion (A) 38 bp after the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 299 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mypn Mutation: 77 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)