Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy
Transgene Detail

Summary

• Symbol: Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy
• Name: transgene insertion 27, Wei Yang
• MGI ID: MGI:6150882
• Synonyms: Sumo-KD
• Transgene: Tg(Thy1-EGFP/RNAi:Sumo)27Weiy Location: unknown
• Alliance: Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy page

Transgene origin

• Strain of Origin: FVB/N

Transgene description

• Transgene Type: Transgenic (Knockdown, Reporter)
• Mutation: Insertion
• Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy involves 3 genes/genome features (Sumo1, Sumo3, Sumo2) View all
• Mutation details: The transgene was designed to have (from 5' to 3') the ~6.5 kbp mouse Thy1 promoter for neuron-specific expression (Thy1 sequences extending from the promoter to the intron following exon 4, excluding exon 3 and its flanking introns), EGFP, a fragment containing three chained pre-miRNA sequences (AATCGAATCTGCCTCATTGAC, GTTTGTCAATGAGGCAGATCA, GGTCAGAGAATTGCTGATAAT) that target/silence SUMO3, SUMO2 and SUMO1 (respectively) and a polyadenylation signal. Six founder lines were generated, founder 27 exhibits widespread expression in the brain. (J:260337)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available

References

• Original: J:260337 Wang L, et al., Neuron-specific Sumo1-3 knockdown in mice impairs episodic and fear memories. J Psychiatry Neurosci. 2014 Jul;39(4):259-66
• All: 1 reference(s)