About   Help   FAQ
Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy
Transgene Detail
Summary
Symbol: Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy
Name: transgene insertion 27, Wei Yang
MGI ID: MGI:6150882
Synonyms: Sumo-KD
Transgene: Tg(Thy1-EGFP/RNAi:Sumo)27Weiy  Location: unknown  
Alliance: Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy page
Transgene
origin
Strain of Origin:  FVB/N
Transgene
description
Transgene Type:    Transgenic (Knockdown, Reporter)
Mutation:    Insertion
  Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy involves 3 genes/genome features (Sumo1, Sumo3, Sumo2) View all
 
Mutation details The transgene was designed to have (from 5' to 3') the ~6.5 kbp mouse Thy1 promoter for neuron-specific expression (Thy1 sequences extending from the promoter to the intron following exon 4, excluding exon 3 and its flanking introns), EGFP, a fragment containing three chained pre-miRNA sequences (AATCGAATCTGCCTCATTGAC, GTTTGTCAATGAGGCAGATCA, GGTCAGAGAATTGCTGATAAT) that target/silence SUMO3, SUMO2 and SUMO1 (respectively) and a polyadenylation signal. Six founder lines were generated, founder 27 exhibits widespread expression in the brain. (J:260337)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
References
Original:  J:260337 Wang L, et al., Neuron-specific Sumo1-3 knockdown in mice impairs episodic and fear memories. J Psychiatry Neurosci. 2014 Jul;39(4):259-66
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory