Naa16^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Naa16^em1(IMPC)J
• Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6151419
• Gene: Naa16 Location: Chr14:79571947-79628228 bp, - strand Genetic Position: Chr14, 42.61 cM, cytoband D3
• Alliance: Naa16^em1(IMPC)J page
• IMPC: Naa16 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATGTTTCGAGTGAATCTT, TATCTGAAGCACTTCTGAGA, ATTAATTTCAGCATTAAGTG and GTCTCTATCTCTTACAATAG, which resulted in a 492 bp deletion beginning at Chromosome 14 position 79,386,780 bp and ending after 79,387,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292003 (exon 2) and 407 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Naa16 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)