Cherp^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cherp^em1(IMPC)J
• Name: calcium homeostasis endoplasmic reticulum protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6151421
• Synonyms: Cherp^-
• Gene: Cherp Location: Chr8:73214333-73229070 bp, - strand Genetic Position: Chr8, 35.08 cM
• Alliance: Cherp^em1(IMPC)J page
• IMPC: Cherp gene page

Cherp^em1(IMPC)J/Cherp^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos show abnormal morula morphology. Blastocysts grown in vitro hatch from the zona pellucida but outgrowths show no defined inner call mass and few trophectoderm cells.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCTGTTGCCAAATTCTATA, CCATTCTTAATGAGTAGGGA, CATCAGGTCCTCTCTCTGGA and CAGTGAGATCAAGCACAACA, which resulted in a 525 bp deletion beginning at Chromosome 8 position 72,470,672 bp and ending after 72,471,196 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463654 (exon 3) and 340 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp insertion (CT) at the deletion site. This deletion is predicted to cause a change of amino acid sequence after residue 66 and early truncation 29 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cherp Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)