Emilin2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Emilin2^em1(IMPC)J
• Name: elastin microfibril interfacer 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6151442
• Gene: Emilin2 Location: Chr17:71559167-71618551 bp, - strand Genetic Position: Chr17, 41.87 cM
• Alliance: Emilin2^em1(IMPC)J page
• IMPC: Emilin2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TGGTGTTGTTACCAAGGACA and GGAGACTCTCTTAAAACTAG, which resulted in a 300 bp deletion beginning at Chromosome 17 position 71,280,606 bp and ending after 71,280,905 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000235473 (exon 3) and 124 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 6 bp insertion (TCTAAG) at the deletion site, that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 91 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Emilin2 Mutation: 55 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)