Ipo7^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ipo7^em1(IMPC)Mbp
• Name: importin 7; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152503
• Synonyms: Ipo7^-
• Gene: Ipo7 Location: Chr7:109617522-109655816 bp, + strand Genetic Position: Chr7, 57.7 cM
• Alliance: Ipo7^em1(IMPC)Mbp page
• IMPC: Ipo7 gene page

Ipo7^em1(IMPC)Mbp/Ipo7^em1(IMPC)Mbp mice exhibit embryonic lethality. No embryos are recovered at E7.5 and abnormal blastocysts are recovered at E3.5. Blastocysts grown in vitro hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 4 guide sequences CCTTGATATTTGGTAGTAGGGCT, GTGCATTGTGTGTTCCATTGCGG, CCAGAAGAGGTTTGTGATCCTCT, GTAGGGATCAAACTTAGAGCTGG, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ipo7 Mutation: 82 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)