Nsmce1^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nsmce1^{em1(IMPC)Wtsi}
• Name: NSE1 homolog, SMC5-SMC6 complex component; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153567
• Gene: Nsmce1 Location: Chr7:125066816-125090615 bp, - strand Genetic Position: Chr7, 68.87 cM, cytoband F3
• Alliance: Nsmce1^{em1(IMPC)Wtsi} page
• IMPC: Nsmce1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences ATGCACTCCCACGAGTTCTCAGG, CCTCCCGTTAGAAACGCTGCATA, TTGGGCCAATGCCAATATTGTGG, CTGAGACAGATGGTGTAGTGAGG, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nsmce1 Mutation: 19 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)