Nr0b1^{em2(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nr0b1^{em2(IMPC)Wtsi}
• Name: nuclear receptor subfamily 0, group B, member 1; endonuclease-mediated mutation 2, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153726
• Gene: Nr0b1 Location: ChrX:85235381-85239553 bp, + strand Genetic Position: ChrX, 39.67 cM
• Alliance: Nr0b1^{em2(IMPC)Wtsi} page
• IMPC: Nr0b1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCCTTTGAGCTTTCGAGGTCATG, CTGCGCCCTTGTCCAAGAGGAGG, ATCAGGAATACCCTGTCAAGTGG, CCAGAAACTTGGCACTGGATTGG, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nr0b1 Mutation: 9 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)