Ifih1^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ifih1^{em1(IMPC)Wtsi}
• Name: interferon induced with helicase C domain 1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153741
• Gene: Ifih1 Location: Chr2:62426142-62476599 bp, - strand Genetic Position: Chr2, 35.85 cM, cytoband C3
• Alliance: Ifih1^{em1(IMPC)Wtsi} page
• IMPC: Ifih1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 Protein, the guide sequence CATACAGTTCAATGCAAGTGGGG, and a donor oligo, which resulted in a Point Mutation allele. (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ifih1 Mutation: 45 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)