Nudcd3^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nudcd3^{em1(IMPC)Wtsi}
• Name: NudC domain containing 3; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153752
• Gene: Nudcd3 Location: Chr11:6055705-6150190 bp, - strand Genetic Position: Chr11, 3.91 cM
• Alliance: Nudcd3^{em1(IMPC)Wtsi} page
• IMPC: Nudcd3 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 Protein, the guide sequence CCCATGCGGTCCGAAGGGTGGCG, and a donor oligo, which resulted in a GGC to GAC (c.155G>A) change resulting in a glycine to aspartate substitution at amino acid 52. Expression of protein is substantially reduced in tissues. (J:237616, J:351330)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nudcd3 Mutation: 23 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)